Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720981
Length 817 bp
Fasta Format > whvh10d24
tatctggtccccggtgcttattgaaaaaactttcagatgacatgaacatc agtggtactggctttggaagtggttctggattaagtggaataggcgctga tatggactcatttgcgagtaaacccnaaggtcgtccgtcagctgctgcta ctgctcctggcaaaggttttggtatgaaattaggcaaatcacagaagaca aatcagttcctacaatctttgaaagctgaaggagaagtcattttggagga tgcacaaccaagttcagtttcttcaagggcctcgcctcttataccaagcg atcccatcacagtgactattgaagagaaacttaatgtaatagttaaaaga gatggaggtgttaataactttgatgtgcaaggaacccttgctcttcaggt ccttaatgatgcagatggatttatccagttacagatcgaaaacaaagatg tacctggactcagcttcaaaacacaccccaatatccacaaggagttgttt aacagccagcaaattgttggagcaaaagatccaaacaggcctttcccaag tggtcaaaatgaaacaccacttgtgaaatggagaatccaggggatgaatg aatcgaatttacctctgtcagttaactgctggccctcggtatctggaaat gaaacctatgtcaacattgaatatgaggcttcagagatgtttgacctgaa caatgttgtcatatctattcctctacctgcacttcgggaggctccaactg ttaaacagattgatggagagtggaagtatgacccaagaaactctgtattg gaatggtccatcatcct
Download
page-top