Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720979
Length 719 bp
Fasta Format > whvh10d19
agaatttccccccgagctacaaaccgaagcaacaccgagaatgtcgatcg tgaggcggagcaacgtgttcgaccccttggcggacctctgggcggacccc ttcgacaccttccgctccatcgtcccggcgatctcaggcggcaacagcga gacggccgcgttcgccaacgcccggatggattggaaggagacccccgagg cgcacgtcttcaaggccgacctccccggcgtgaagaaggaggaggtcaag gtggaggtggaggacggcaacgtgctggtcgtcagcggcgagcgcacaaa ggagaaggaggacaagaacgacaagtggcaccgcgtggagcgcagcagcg gcaagttcgtcaggcgcttccgcctccccgaggacgccaaggtggaggac gtgaaggccgggctggagaacggggtgctcaccgtcaccgtgcccaaggc ccaggtcaagaagcccgaggtgaaggccatccagatctccggctgagtgc atgcgtctcgacgtatggtcatcaaggatggagccagtttggttgatgcg tgtgcgaggtctgcaacctgaatgtatgctacagttgtgtctttgttctt gccgatcgagtctggcgaggcatctctgtactgcgtttctttcnctggtc gtttctgttcttgtgtaatcnccaacanatttgatgatgaataaatgana aataagccgttccgattta
Download
page-top