Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720974
Length 667 bp
Fasta Format > whvh10d10
gtggccgattgagggtatcaagaagttcgagaccctgtcttacttgccac ccctctccacagaggccctcctaaagcaggtagactacctgatccgctcc aagtgggtgccctgcctcgagttcagcaaggttggcttcgtcttccgtga gcacaacagctctcccggatactacgacggtcgatactggacaatgtgga agctgcctatgttcgggtgcaccgacgccacgcaggtgctcaacgaggtg gaggaggtcaagaaggagtaccctgatgcctatgtccgtgtcatcggctt cgacaacctgcgccaggtgcagtgcgtcagcttcatcgccttcaggccac caggttgcgaggagtccggcaaggcctaaactacaagttgaaacaatggc ctatgtatgatggtcatttgtgaacttcacttttgtccacgactctgctt tccgaccagagcatatttctcgttccatatgatctgtgtttgtacgaaca taggttgtggagcatgcatatgtaaattctagcgaaaaatctatactgaa gtcgagaggggctcggggctccgctgctaaccctacccgctcccttgtgc cgccgccgcgctgcatcagagcgccaaaaaaaaaaaaaaaaaaaaaaaaa aaaanncnaaaaaaaaa
Download
page-top