Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720967
Length 818 bp
Fasta Format > whvh10d03
caccgcttgtgttcttgcccgggaaatcatcaagctgggtattttgagtg taacttctggtgcaaaccctgtatcgcttaagaaaggaatagacaaaact gtccagggtttgattgaagagcttgaaaggaaagctagaccagtcaaggg cagtggtgacatcaaagctgttgcctctatctctgctggtaacgatgaac taattggagccatgattgcggatgcaattgacaaagtgggtccagatggt gtcctttcgatcgagtcgtcttcatcttttgagactactgttgatgttga agaaggaatggagattgaccgaggctacatttcccctcaatttgtgacaa accttgagaaatcaattgtggagtttgagaacgccagagttcttataact gatcagaagatcacaagcataaaggaaatcattccacttctggagcagac tacacagttgagatgcccgctgtttattgtagctgaggacatcactggtg aagctttggcaactcttgttgttaacaagctcagaggtattattaatgtt gcggcgatcaaagccccaagtttcggtgagcggcggaaggctgtccttca ggatattgccatcgtgacaggcgctgagtacctagcgaaggatcttggtc tgttggttgagaatgcaacagtagaccaacttgggacagcaaggaaaatc acaattcatcagactacaaccaccctcatagcagatgcagctagcaaaga cgagatccaggccagggttgcacagctaaagaaggagctttctgaaacgg attccatctatgactctg
Download
page-top