Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720961
Length 807 bp
Fasta Format > whvh10c20
gctatatacctacatagtacagccatggcccccaccgtgatggcctcgtc ggccacctccgtcgctcctttccaggggctcaagtccaccgccggcctcc ccgtcagccgccgctccaacggcgctagcctcggcagcgtcagcaacggt ggaaggatcaggtgcatgcaggtgtggcccattgagggcatcaagaagtt cgagaccctgtcctacttgccaccgctcagcacggaggccctcctcaagc aggtcgactacctgatccgctccaagtgggtgccttgcctcgagttcagc aaggttgggttcatcttccgtgagcacaacgcatcccctgggtactatga tggccggtactggacaatgtggaagctgcctatgttcgggtgcaccgacg ccacacaagtgatcaacgaggtggaggaggtcaagaaggagtaccctgac gcgtatgtccgcatcatcggattcgacaacatgcgccaggtgcagtgcgt cagcttcatcgccttcaagccaccgggctgcgaggagtccggcaaggcct aaacagctcactcacgacaggccatatataaagtgccattgcagttttgt caactctgacattgctttgggttttccttctccatttatctttcttattt gttcctaanaatatgtgtatgtccatgttcatgtaccaacatggctcgag aaagcatgctcgtatgagaatgctatcggtggctatgtatatgaacggac gcataatattatacaatatgtcgactatatacgttttaatggtaaccaaa aaaaaaa
Download
page-top