Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720956
Length 702 bp
Fasta Format > whvh10c12
acgaggggataagagagagagacagatcgcgatgaagtcttggttcgtca ctgctatagcggcactagtgctgatagccgcacagcatgcctccctcgtc gccgccggcagaggccccagggtcatcatagtcggcgccggcatgtccgg gatctcggcggggaagcggctgtgggacgccggggtgagggacctgctga tcctggaggcgacgggccgcgtgggcgggcgaatgcacaagcacaacttt ggcgggctcaacgtggagatcggcgccaactgggtggagggcctcaacgg ggacaaggtgaaccccatctggcccatggtcaacgccagcctcaagctcc gcaacttctactccgacttcgacggcgtcgtcggcaacgtctacaaggag agtggtgggctttacgacgaggagttcgtgcagaagagaatggaccgcgg cgacgaggtggaggagctgggcggcaagctcgccgcggagatggatccca ncggccgcgacgacatctccatcttggccatgcancgcctcttcaaccac canccgaacgggccggcgacgccggtggacatggtgctcnactacttcan gtacnactacnanttcnccganccnccncgcgtcaccancctgcanggca ccnanccnacngccaccttcnccnacttcngngatgacnccnactttgtc nc
Download
page-top