Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720953
Length 849 bp
Fasta Format > whvh10c07
gccaccaaatccaatctcgagcccccctctcccgtccgcccgtcccaacc cgatccgatctcccccctcctcctccgtcgccatgggccgcaagttcttc gtcggcggcaactggaaatgcaatggaactgtcgaacaggtagagagcat cgtcaatactctgaacgctggacagatcgcctctacggatgttgtcgagg ttgtcgttagcccgccctatgtcttccttcccaccgtcaagggtaagctg cgcccagagatccaagttgctgctcagaactgctgggtgaagaagggcgg tgctttcaccggtgaagtcagtgctgagatgcttgtcaacctcggcgttc cctgggtcatccttggacactctgaaaggaggagcttgatgggagaatca agcgagtttgttggagagaaggttgcatatgcactcgctcagggcttgaa ggtcattgcatgtgttggtgagactcttgagcagcgagaagctggatcaa ccatggcggttgtcgctgaacagacaaaagcaattgctgacaagatcaag gactggaccaacgtggtcgtcgcctatgaaccagtgtgggccattggcac cggtaaagttgcatcaccggctcaggcacaggaagtccatgccaatctga gggactggctcaagaccaatgtgagccccgaggttgctgaatccacgcgg atcatctatggaggatctgtaactggcgcaagctgcaaggagttggccgc gcagcccgacgtcgatggtttcctcgttggtggagcttccttgaagcctg agttcatcgacatcatcaacgccgccaccgtgaantctgcctaagcaag
Download
page-top