Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720952
Length 803 bp
Fasta Format > whvh10c06
ctctgtcttcttcaagactcaagctgatggccacgtttcctgtgccaagg agatgaccaagctctctggaatctctgacattatccctgagatggaggtc tgtgacttcgacttcgagccctgcggctactccatgaacgccatcaacgg atctgccgtctccaccatccatgtgacccccgaggacggcttcagctacg cgagctacgaggtcatgggcatggacgcctccgccctggcctacggcgac atcgtcaagagggtcctccggtgctttggcccttcagagttctctgtggc ggtcaccatcttcggtggccgtggccacgccgccacctggggcaagaagc tccaagctgaggcatacgactgcaacaacgttgtggagcaggagctcccc tgcgggggcgtcctcatctaccagagctttgccgcgaacgaagaggttgc tgtctctgccgggtcgcccaggtccgtcttccactgcttcgaggccgaga gtgtgcagagccaccctctggtcaaggaaggcaagctcgccaacctcctc gcatggcgggcggaggaggattccctggaggagggcgcggtgctgtgcga gtgattggctgtcgctgttccgtctgtggactttgttctgactaantttg tcgtttggttactgtgaancanctggccangctattgctactccnaataa actattanctctangtggtttgctgcntctgccacaatgancgtacttct gggganaanttgtctcaaactgataaataancattttttttctaaaaaaa aaa
Download
page-top