Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720951
Length 528 bp
Fasta Format > whvh10c05
agccagccaacagagcatcatggactcccaaattttcgagacatttgccc ggtagttaagttgatagtgactcatcagtgttcagtgcagtcagcccctt attgggaagctacatacataacagttctgaagggaggaattgaatgttgt cagataattgtcggaaagcaggagtccgtgtgtgtatcgttgtcgtggtt tacctgtaactgtagtgttgtacatggttagatcattgttcatccagagc aagaaggcttgtaatgtgttccgtattgttccgtataccgtgttcgttac cgtttaggacgctgcttgcacagcgcagctatacaagttttactgagtta gattggctggaggaaaactacctccccgtgatgttgtaactgaagtctgt tgttgttgattaaatttgttataggaataaattaagtttatttgagtaac ctgaaccaagtggttggtttaagttgtatcctgtttggagcgtaggagga atataagaataccttcctaaaaaaaaaa
Download
page-top