Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720949
Length 662 bp
Fasta Format > whvh10b24
atggaggcgtcgctgaccgcggccgccgccgctacctcgtcgtttccgcc gcaaatccgtcgccgaatcatcaaattcaacccgctcgtgctccctaggc gaccccaattcggggactccaagatccggaccgccaacttccggggacac ctggctgcggcctcggcatccacgccgccgccgccgggaggcggcctgta ctcggcggcgacgtacgaactgacgccggataacgtcgaccgcgtcctcg acgacgtgcgcccctacctcatctccgacggcggcgacgtcgccgtcgtg tccgtagaggacggcgtcgtctcccttaggcttgaaggggcgtgcagcag ttgtcccagctcgacgacgacgatgaacatgggcatcgagcgagtgctca aggagaagttcggtgacgccatcaaggacatccgccaggtgttcgacggg gaccagcagccggaggagacgacgcctgaggcggtgaaccggcacctgga catactgcggccggcgatcgcgaactacggcgggagtgttgaggtgcttg ccgttgacggcgaggactgcctggttaagtatgacggcccanagtccatc gggagtggagtgaaggcagccatcaagganaanttccccgacatcacgaa cgtggtgttcac
Download
page-top