Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720948
Length 693 bp
Fasta Format > whvh10b23
agcacagcggagaagaggaaggagagagagatgactgcgtccgtctccta cgggctgcgagctcttccgacgtggtccagctctgtgtccggtgacgacc actgctcggcgctggccatgtcggtgtcggcgcgggggccccggtcgacg cggccccttcggacgccggcgaggatgggcaatgtaaacgagggcaaggg catcttcgcgcccctggtggtggtggtgcgcaacatcgtcggacgcaagc gcttcaaccagctcaggggcaaggccatcgcgctgcactcccaggtgatc accgagttctgtaagaccatcggcgctgaccccaagcagaggcagggctt gatccgcctcgccaagaagaacggagagaagctcggattccttgcttgac ccgcctcacaatccccccttccttctcctaccttttctactagcaaaaag gaaattccttggagttggagattgcatgcatgcatgtatgtatactagtc ttatatattttttcttctcttctcttctcttctcttgtggagacagcact gagttcagttaaacttcagttccatgtggatagatggatggacagatgat gtatctatcctctactgatgacctcagcggtagagtatatatatgcgcaa tgctactggataaataattcaagtatttgtctcaaaaaaaaaa
Download
page-top