Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720946
Length 460 bp
Fasta Format > whvh10b20
gcgttgctggtggcccgctcggagagatcgtcgacccactctaccccggt ggcagcttcgacccccttggcctagctgacgatccagaggcgtttgccga gctcaaggtgaaggagatcaagaacggccgccttgcaatgttctccatgt ttggatactttgtgcaggccatcgtcaccggtaagggtccgcttgagaac ctcgctgaccacctcgccgaccccgtcaacaacaacgcgtgggccttcgc caccaactttgtgcccggcaagtaaacacatgagaatcgacttctcagga gtatatgtgtgctctggatgtatgattaatatctgatcgttgatgttgta cactatcaaagatgtttacaaatagcgcccatctggaacatgaaatgtct atatgagaaatgcatggttttcattttccatatgaatacgagtggacatt aaaaaaaaaa
Download
page-top