Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720943
Length 809 bp
Fasta Format > whvh10b10
aggtcgaccaagcagcaccgagatggctgctgccttctcctccaccgtcg gtgccccggcttctacgccgaccaacttccttgggaagaagctcaagaag caggtgacctcggccgtgaactaccatggcaagagctccaaggccaacag gttcacagtcatggcagcggaaaacctcgacgagaagaggaacacggaca agtggaagggtcttgcgtacgatatctccgacgaccagcaggacatcacc agagggaagggcatcgtggactcgctcttccaggcgcccacgggcgacgg cacccacgaggccgtcctcagctcctacgagtacgtcagccagggactca agaagtacgacttcgacaacaccatgggaggcttctacatcgctcctgct ttcatggacaagcttgttgtccatctctccaagaacttcatgaccctgcc caacatcaagatcccactcatcttgggtatctggggaggcaagggtcaag gaaaatcattccagtgcgagcttgtcttcgccaagatgggcatcaaccca atcatgatgagtgccggagagctggagagtggcaacgccggagagccagc caagctcatcaggcagcggtaccgtgaggctgcagacatgatcaagaagg gtaagatgtgctgcctcttcatcaacgatcttgacgctggtgcgggtcgg atgggcgggaccacacagtacaccgtcaacaaccagatggtgaacgccac cctcatgaacatcgccgatgcccccaccaacgtgcagctcccaggcatgt acaacaagg
Download
page-top