Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720938
Length 575 bp
Fasta Format > whvh10b05
gccagcggcctcgcacgccgctgcattgtgcagatctcatacgccatcgg tgtgcctgagcctttgtctgtgttcgtcgactcctacggcaccggcaaga tccccgacagggagatcctcaagntcgtgaaggagaactttgacttcagg cccgggatgatcagcatcaacctggacttgaagaaaggtggaaacaggtt catcaagaccgctgcttacggtcactttggccgtgatgatgccgacttca cctgggaggtggtgaagcccctcaagntcgacaaggcatctgcctaagag catggcattctcttggtctgccgcctctcaagttcgtcaagacgggatca tgttgctcctggnaagtgggaagaagcattanacattgaagcgacgctct acactggtcttgttgtatggtagtcantgctaagtttcttaatgtcattt catatatttatcctttccattttgagtcgctgaaactgctgagtgatgtg cagtttgctctgttagtcgctctgtcactttcacttttcatattctttgt tgtgtagttcctcataaaaaaaaaa
Download
page-top