Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720931
Length 783 bp
Fasta Format > whvh10a17
tcttgattcagttttcgcctcactggcacatccattctctccaggctcta gcaccgtcttgcctccggcagttggagacggagcatctggtcatggaaag ccgcatcaggacgttcggtgcggtggtcatggcgcaccatgctgggtcta cttcaccatcgtcgtgctccgcagccgcctacagccgacgcaccgatgag gtccgacatggagcacagtagcaagcaccagtttgaggcgaggtatatcg cattggtctcctgctgctcacaggcgaggcctcggacgagcggccaaatc cacgtgaggtggatgttgcaggttcgtccccaattataaaatttggagcc tcccgctgaaggtccaaggaggtggaagcatgaacaatgccctcatcaaa tcaatttaactggattcgaatcgaaggatgactttcgagaaaagttgttt tacaaattgaggaggggtagcagatggatggcattgccatgcagaactga aaacactgttgtatgactacagactcttcactggaataaaaatagttatg tggtgtttggtcggacgtgcgcatttgcagcaccatggggtggagcacca tgtataatttatggctaaatcacatcggcagggaagcactatctaggacc gtttanacactacctanaagagtgttatgtctacaaaggtacagagttcg gacactanctanaagagtgttctgtctacaaaggtatanaaagacaaata gtttcatttctcatgttgatantcantgtanaa
Download
page-top