Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720929
Length 666 bp
Fasta Format > whvh10a11
cgtttttttttcatcgctcatatataatttttattcatttccgtgccccc aacactagtttcaacgacttcaaccaaaaaaaaagnggaggaacattttg tacacccttccggactgccaccggaagagggccncccatgcatgattcac tgaatttacaggaacatatctcatgagaacaacatcaaaccacccaactc aggnggatacncgtttctgcgaggaaaaaaacaagatcccaaagnggtcc ggcagtaggagttaatgaccaaaattgtatgcatcttattttccttgnga aaaatgngaccatagatgatcttgggagagaaaaaaatatgaacagttaa cttgttcanaagcctcctcatttcgagctgaacttgccacgcaccgtctc gtaggctggtacnttgagaacgtttccgngagatgccattgtcaatggng acganatgatcttctcagcaacagttgatacntctgccanagttatacca tcaacagccttaanaagctgctccacgggtttcctttcaccaaatgccaa tgcttggcgcccgatgtcttcagttgttgatgcctttgattccaggttct tcaanatagctgattttgcanatgctttancacggnccagttgggcttgg tcaacttgaccaggag
Download
page-top