Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720928
Length 714 bp
Fasta Format > whvh10a09
atgggctggcagctgaggcttggcaggatgggggagttaattaaggtcga gggagcaggaaagagtttgttattcgctattggcttagtacggcctatac ataatagggccatgacggttttggcaaggccttgaacttcatatatccct tttttactcaatccagaatactgagaaagtcagattgaattattttgtcg acctttcctttggatttattatcataggtagtgttcgagatcgcctctgt gcggtgaacgctcgaatgtagctaacatcagttttgtcctcgcgtggttg aaggagatgctgctgctggatggaatgcttccggggcgccatgatccttc tatcaggaatagaataatcgagggcactgactgactgcatcaatcatcgc tcagtgagctattaattgccgccaatagcgcttcgcttgcatgcaaggcg gctaataaaagcgctaggtagacgcgcggagatgcattttgagtactggt ggtactggacaagctctaggggaataatctctttcttatttctttcttat ttttttcccatgacgactaggaacgggcaaattaagaatttcactttgaa ttttggacctcaacatcctgctgctcatggtgttttacgattagtattgg aaatgaacggagaagtggtggaacgtgcgggaaccacatattggattact ccatagagggatcg
Download
page-top