Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720925
Length 554 bp
Fasta Format > whvh10a04
atgatacttcgtttcttgcgtcggcggatgtcatggattactcgcttctt gttggaatcgacgaggagaagaaagaactcgtcattggcatcatcgatta cttgcgccaatacacctgggacaaacaacttgagacttgggtgaaggcct ctggcatcctgggaggccccaagaacgaagcccccaccattatatccccg atgcagtacaagaagaggttcaggaaggccatgtccaagtacttcctcac cgtccctgatcaatggacctcttaacaactactcgtagcgattaactaga ccgccagaagcgttctggcaacagcgaatgttgcggtgaggatcagctga ttcattttgtacacagttgtggcaattgggctgtaggcataggtaggatc accctctccctggataccaagcatgctaattgcagtgtccagccaaagat aggaggtgtgatcgttgtacattgtgaccaacatagttacaagacaaagt tatcatataatgcagaggaaggtacttctgctacattaggttgtaaaaaa aaaa
Download
page-top