Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720924
Length 555 bp
Fasta Format > whvh10a03
atgatacttcgttttcttgcgtcggcggatgtcatggattactcgcttct tgttggaatcgacgaggagaagaaagaactcgtcattggcatcatcgatt acttgcgccaatacacctgggacaaacaacttgagacttgggtgaaggcc tctggcatcctgggaggccccaagaacgaagcccccaccattatatcccc gatgcagtacaagaagaggttcaggaaggccatgtccaagtacttcctca ccgtccctgatcaatggacctcttaacaactactcgtagcgattaactag accgccagaagcgttctggcaacagcgaatgttgcggtgaggatcagctg attcattttgtacacagttgtggcaattgggctgtaggcataggtaggat caccctctccctggataccaagcatgctaattgcagtgtccagccaaaga taggaggtgtgatcgttgtacattgtgaccaacatagttacaagacaaag ttatcatataatgcagaggaaggtacttctgctacattaggttgtaaaaa aaaaa
Download
page-top