Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720923
Length 344 bp
Fasta Format > whvh10a01
gggtctttgtatgtatgtacgcacctgcctgcatgagcagagcgggtgcc atgccatgcatgtaaacccctaaataaaatctcccgtggttttgcttaca tcgtgttgttagatcctcctcctattagtgttgctttcgggttcttctta tgcacgagcaggatcagaggccggtcttttgttcttggtcttctcctcaa actgtcgttttcctcttctctatggtccatttgcggcagtattttcttct tctgttgccgagttctgtatcagactgccttgttttgtggtttatcccta ttcatcttgaaatataggtatagcgcatgaatttaaaaaaaaaa
Download
page-top