Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ611376
Length 707 bp
Fasta Format > rwhva9d05
gggggatcatatcatgagtaggcgaggaagaaacaataacagaagctaaa atataaaccgacaccctgggtttagattactagatacacacacaaacaca cattgttgcctcgattgtttcctctccaccgatcaacccacgtacgcatg cacacaagatgagtatcttcacttctgctctgctctagttagactcgagc tgcgcgtaccacacaccctggatcttgacatccttgggcgccttggcgcc gaggtcggtgtctgacggctgcacgctctcgaagacgccgatcacctcgc cggtctccggcttgctcttggtgacgctgagcgtgatgttgcccgtggag gaggacgcgttcttcacgttctccttggccaactcctcctcgtctcctct gcctccggcgggtagcgccacggcgttgtcgtagccagtagagccaccac ggccctttgggtcgaggaaagacgaacccctgtagctgggcacgaggaag ggcccgctgaagctctcgggcttgccggtggcgacgagctgcttgacggt gaagaggaagggcacgcgctcgcctccggggagctgcacggtgacggccg cgtagtcgatgccgtccttctcctcgaacttgagggtgccgtcggcgccg acctcnagcgggccttccatctcgtcaagggtgtangtgagacgggtcat gancttg
Download
page-top