Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ610915
Length 661 bp
Fasta Format > rwhva7c14
gacaacggattcgagaattcatcagaaacagtacagctacttcatatatg tagcatagatgtaccgatgcaattctacagttacaacagctagtgccata actacgacattgtatggataaatcattgtacacgaataatcacggaacta gatagcgacatagtaacaacaatgctctcttgtctttcttcattcctcgc acagagagaagggggctttgaagaggattattctataaaaattgctctac agcaggaatcctctaccctcattgcaaaggaagatccttgtgggtgtaca caactcccttgtcaccgttcactacttgtccactccctcgcagaatgcac cgagtggttaaaagaccgtcgacgccaacaggtccacgggcatgtatgcg ccctgtacttatgccaacctctgcacctagaccaaagcgagtcccatcac agaaccttgtgcttgcattatggaacacagcagcactgtcaacttgttgt anaaaagtatccgctgacttcttatcagttgtgataatacaatctgtgtg tgcacttccataacgatttatatggtcaatcgctgactgcacatcatcaa cnaattcgagggtgcatgccattgagctatactcatgatgaaatgaatct accttcggnac
Download
page-top