Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ610792
Length 817 bp
Fasta Format > rwhva6j11
agtgttatactccaacatatcttttccttctacaaatcaaagaaatgcaa ccagcataaccccaccaaagcttgtatacaccgcatacagcgaaaaacca cacagcaacaaaattggagtgcctgggtgtacacgacaccaacacagggt cgtcggtttacaagatatatggcatttcagttcttcctgtgtgagaaaat acctgccccccttttcaaccataaaccgccaatacggatcacgcagtcag gggtagtagaataaagaagacgtcgtcgactgtgcatctgctttggaaag atatcaagcagtagcttcgttctctttgaatatacgaggaaggatctcgt ggatggtaatgtccaagggctcagggctcctgcacaatgctcgtcccttc tctgttgtgctagcaacaaaccatatcttccgtaaaattggtgattcaaa ttgtacaaagaacccatcactctggtcaagcttccattttcttgatcctt gacctttccagacctgtggataggagatgatgctcttaggtgctaccata caggcagcctttgaaaaagactcctcagagtattgccgcaaatatgcgaa gcaactgccatgggtatggggtgactcaaaggccttctcaatgttaacca ctggggcatatttttcagtgtcagtcttctgatcatcaagaagaaaatcg accttagcatccacctttcctgtgtcatgccaaacctttatcgctgattc aatcacactgataacnaatgagaatatattttgtcccattttttgcatct ccatacnttgtaaccag
Download
page-top