Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ610723
Length 424 bp
Fasta Format > rwhva6f05
gggattggattacaagcagattgattacatggaggggatcgatttaccga gcaagagaacagcacgcggacaggcaagagctagctagtagtattggtag tacatggcgcatctatggggtatggggtgtcagtctagccggcgtagatg tggatgtggagggcgagggtgaggatggtgaaggcggcgaagaagaggag ggtgtggacgaagatggccttgccgttggtgtggaggccgccgaagtcga cgtggcggtgcgaccccggcatctcgaacagcagccccggcgagagcagc acgaacagcaccacccccaccaccaccggtgcccagtccgccatcctccg ccgcttctccttcttccttggacttcggtcgatctgatctgatctgatct cacggccgcagatatggatcttgg
Download
page-top