Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ610636
Length 650 bp
Fasta Format > rwhva5p06
aatctactttagaaatacattaaaaactaacaacaatgtagcaaaataat tgtactaggggacaacactcaggtgcatgctaaatacttgccactttatt attgaatctgcatgcagaagagtttaatcgataagaccctcttaataatt aactacgcactaattgttcgaccaccatcaacggtgatgacttggccggt gacgaaggatgccgctggcatgcagaggaacgacaccactgcagccacct cctctggctcgcctgcccgccgcatcggattctttgccaactcgttctct ttaatttccggtggaacactgtttaacatgtcactcttggtcgcgcccgg ggcgacgcaattcacccggatcttgttatgagcccattcggtagcaaggc tccttgtaagctggttaattcctccttttgtcatactgtaaatcgcgagg cccgggaatccaagtgtgcccccaagggaggatatgttgacgatgctacc tcctccagcgatggatgccccgaggagcaaggggtgcgtgagctggctca ggtggaagcacgactctaggttggtcgccatgaggtgcgtgtactcctct gatgtgcactccacagccgccttggcaacagcctgcgccgcgttgttcac
Download
page-top