Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ610618
Length 550 bp
Fasta Format > rwhva5n19
ttctatttgtgaaacaatgacctgctacaaatgagccatttcacgctcaa gagctctgacgcgtttaatccaagtcataaatattatttctccacataac aagacccaaagtaaagtaaatacacgacaacaggaaatataaaaggtaaa caaaaacagatgtgaagtgcctaatatagagaagcctaattcagatattg gctatcctctcttcgctgcagctcaattcccctcccttagatcggcatgc ctttgggcacaatctggtcctttatccacatgtaaataggcaccagaaca tagtacgcggcacatattgttcccatgaggaagcggaagaaaaaggtgat aggattcacgggcttgctgacgtcttcagccttcggaccaagctgtaaag gggagtccccgctttctctcttgacgcccgtcacagagcaccccatgatc aggccatgcctacggacaccacggtaccattttggtccaatcctcttcag ctgaacatccttgaaccctgcctttgtgaaccattcgatgtactcctctt
Download
page-top