Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ610543
Length 567 bp
Fasta Format > rwhva5i16
gagcatgagatagttctaactgtatattcactgtggccatccatctagca caaaatctaaaatagaaaagtaacaggttacggtacatttacaacgctac attggaagaactgtattggtgcctcgctgcccggacacactgcttgatgc tcctcggttcgtcggttatgataggcggtcctgtacggttgggccagcat acatgccagggcgcatgttaatgtacacaggcgagtttatggcttcaatc caggcatagttatctgggctatcgactgtctttgcgcggccactggagaa gctggaaaacggataatcattaaaataggtgcaaattcgaccagcatctt cagcgtatggtggggcaagtacatcaagaacagcacaagaggcaactgaa gtgaaggagtgtaggttcccgccactttggggatacaaaacggtagttgg acatggagcagtaagaacatcatctgcatgtaacttggccagtttcactt gccgattactcgctagaacagtaggttctacccagtcatatggttcgatg catgtgaaatcatatga
Download
page-top