Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ610539
Length 773 bp
Fasta Format > rwhva5i11
gccgaggcattgaccaaaacacaaccacaccaatttcacgattaccatta caaagcaaataccacaattatcagaaagttttcgagacacttaacatctg atagttactgacaccaacattggagagtcgactgacaaccatacatagag cagagcaaaaatactgacgaccccaaagattttagcatactgtgccatta gcacttgacctctttcagcccatgtgcaaagtacaggaaagttggatcag cagctccctccttgtagtacgcgaacaccacgccgccatcatcatgcatg ctctcgccaacaaagaactgaaggtccttgagcttgctaagaagatactt cgtggcagactcaacattcttcttgaaaacatctaggtcatccccttcaa gcttggcagtgaggttcttgatgtagcgcttcatgtgagagataaactgc ttcttgtcaaaagcaggttgctcctgaagacggaaggtgtcaacaatgtc aaccaccttcacggcctggtcatcgacaccctcatcgtcaccaccaccct cagcagagggattggctccaatgtccacatcaactgctccttgaacgacc caatggccatcgacttcccagagcacgccgttctccagctccctgtacgg gaaggaatccgacagaagctcatcgccggaaagcttgtcctggtacacga gcatggtgccgcctcttgagatttctcccccgaaaaaacagaaaacccta acgagctccgggggaaggcaggg
Download
page-top