Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ610333
Length 509 bp
Fasta Format > rwhva4k13
agctttattctggttcacgattagcgcttatttaagcgctgcacgggcgc gcgataggggctgatggccgccaagcacgcacgcctgcatacgctatacg actgtgcgcaacatcacacatacatatactgctgacatgcatacatatac acacatcgtagtgtgctccgttacgtgtaagctcagtcatcggccctgac gacgaagttctccttgcgctcgtggaactccccggtgcgggtgttgaagt cctcctcgagcctgctctcgcgcacctcgaagtgaccagagccgcggccg tggtgaccgtggtgaccgtggcggcggccggaggtgtcgaactcctgcac gaacgtctccttgacgatgtgctcctgcacgccgccgccgcggcgggccg ggttgcccaccgccctcacctcctccgagcagtagtccacctcctggaag tgcgccatgccgatcggtcgatgttactatgtgcttggttgggtttgtgt gtgttggtg
Download
page-top