Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ610288
Length 711 bp
Fasta Format > rwhva4h17
cccggaagcaaacaacaaacagttgctcaacggaaaaggcccaagagcac agacttgttcagacttctatagcaacaattccgtcaaccaaaacaaactt ttatatcagcaacagcaacagaaattctgtcgcaattaatttgggaaggg gcacgagctacaggccatggacatgaaaccggaaggaggaacagtgtcat aatctgcattttatttcatgcattgtgatgctacgaggagcaaaagctgt ggcgcatatcaaggaaaaatgtcttcaaggaagggttctctcgtagaggg gaagggctcccagtgctttacgctctgctgcctcctttttcaccagagcc agcatgtcgctcaaatagcttttgaatggtgtctgcagtgcccggacgtc gtcggggaggtactggtgcttcatggagaggtccatggcgcgcttgaggc gctggtggcgggcgtcgaccacctcccggggcagcctgccgagcgcctcc ttgatgtccagatcgaagtaggggtcgtacaggtcgtcgtacctcaggcc gtagttcttgaggcggttggagatggtgagcatgtggatgcgggccancg ggttgcggcgcgggttcacgaaccacgacgagaacgcggacagcatcgac gtcatcctccgcngcngcngcngcngcnatcccctttcntccctcntgcc naattcctgca
Download
page-top