Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ610280
Length 614 bp
Fasta Format > rwhva4h02
tactttcagtttcaagatcctaaaatcagaaccaaaattactaacagata tccatcgctcgatagccaaaatacagagattgttaagtcttcactccact acagaacccctggattcctcaagacaacagtagggcaatcatgcttcggt ctgctccctcaagcgacggatcgtgctcctgacggtgactgcactagcag tgttcatggtataggcgccgccagccttgaccttgccacagtccttgcat ccccaaattccaacagctttcctcttcacagcaaacttcccacagaattc acagaagtacttggagtgctgagacacctccatcttcttgatctgcttac gcaaactggcaccatacctggtaccatacttcccgacgattccggccttc ttggtgcgcttcgtcatctcggcggcgggtagcaggaggcggctgcggcg gcgtaggagagagagagagagagagagagagagagagagagagagagaga gagagagagagagagagagagagagagagagagagagagagagagagaga gagagagagagagagagagagaganagannnanannnaganananagagn gngnggagagagag
Download
page-top