Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ609783
Length 606 bp
Fasta Format > rwhva2g03
tcggganccatacataattatcaggcttgtgctttgatgcgatgtgcgcc aggatcgaccattttcattanagacttcaaaaaaaggtactcaaatcccc acagctgaatgtaatataacacaatcagatgcagcaaaggagcaggtaca aacataacggaagcaattcgaaaaaaatgagaattattcctggcttggtg cgtccttagaaacctccatgggctctgctgcttctgctgcatctcctttc ttgcctttctttttcttgccaccacccttcttctttgactttgtgcccaa agcaagccaagccttgatctccacgtcgtcctcgatggattttgagggct ccagttgctgtagtggatgtgacgttatcttgtcanacccatttggcatc aacaacacggtgaatttgatgtgggcaaccaggtcccctggcttctcatg tagaacagggtatggctgcaacagctcatgattcatgcattctaccaaac ctaagcgtgcacgcttctcctccagcgccctagcagtgaatggcatgatt gggaacttctggctaatctcactgaagatgaaccttgatgccttcatctt caagtg
Download
page-top