Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ609424
Length 477 bp
Fasta Format > rwhva1p13
gttatagtatcgtagtatgatcgatccatgcaaagattgtgaggaatgtg taaattcatttatacatggactctttgaagcaaccaccatcgggaagaga tcacatgatctgcacccatcgtacatgcatgccaataattaatctacttg aagaagtatgggaggtcgagcacgtaaaggaggaagtaggcccaggtggc accggagacaccaccgaagaagaagcctccggtgaactgcgaccaccctt cagcggtctgcagcttgtcggcctccttcttgcggcctgtgagcgtgagt gcgggcgcggttgacggtgcgccctcgttgaangacgcgacaccgtacat ggtgaggcagacgctaaggatggagacgaggccgatggcgccgagagtgc ctgcctggccgtgaattggcgtgttgcggagcgggccggtgagcgcgaag gggccgaccaggaggtagccgtgggcg
Download
page-top