Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ606692
Length 392 bp
Fasta Format > rwhva10a13
attattgtagacaagagtagtcgacatggttgcaacaaaaaaggaacgat aatcgagcaaggagcactagtgggcgtcctcctcctcgcagtgcttggtg tacttggccgagtccagcaggccctccanctccgccgggctgctcggctt caccttgatcatccacccctcctcgtacgggctcgagttgataaggccgg gggtctcggacagctttgagttgacctcgacgacctcgccggagatgggc gagttgacgtcgctggtggccttcacactctccacgttgccgaaggctcc gccctggctcaccttcgtgccggcctccggcagctccacgaacaccacct ccccgagatggccctgggcgtggtcactgatgccnatcgtgg
Download
page-top