Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ607745
Length 504 bp
Fasta Format > rwhva14e08
caggaggtagctatgtagattacagagacgtgcatgcaagcagagacccg gccctgtgttacacgtagatgctctcttagccggcgagagcgctggtgtt gtagacgaggaggacgccgccgccgaggaggccggcgagggtgacggccc agataagaagcccggtcgttccgccggcgtagcggtcaccagattcagac cattcctctggcgtgtagattgggctgtagccgtcgacgttggcgccgta cttgtcaacgaactggtacacgcccttcttgcccaccttcctgccgttgg cgtcgatgtcgactgtcaagccgcctccaagtccaaggggcttgtcgacc ttgatcttcttgccaccgctgcagacgacggcgaaggaggaaccccggcg ggagagggaggggacgctcgtcggcgccacaatcggcgaggtgatcatgg aggctgccatctcgcgcgcgctctctcaagctctgtctgtctgcgcttgc caac
Download
page-top