Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ607643
Length 715 bp
Fasta Format > rwhva13o08
catggtagcatataggccaaggagataagtacagattttgtctatcagaa ccaactgctgatttatactgtaggtacaaagcagctacactattataatt tgtcggcaaggatagcatagcacggcactttaaaggccgacacgcttctc gaccttctggatctgattcaagaatatccaagtcatcatgacatgtggag caatcctgacacagtagaccggaaagccagtgtagaacttaaatggacca ccactcttcaaggtcttcattgcacagtcaagagacccagtgtatggata ctttccagtagcatcaggttgcatcttctgaacctgtgtcttaacatagt cgaagggcaaactgcaagcagacgcgaagaatcctgaaacagcactggcc ccaagcattgtagaaagttcaccagcaccaagtttgtctctaagtacctc aacactctgatcataggaggcaagcatgcccatgtttagtgacatcgctc tagctacagttggacctgcgcccttccaaagtgccagaacaccttcatca gcaataatacgataaagtgcatgaaaagcattcttatagtggcggcgctg ggctgctggcaaggttgaatcagcctgcatcctaatgagtgccaaatccg caggactaccaaaacacgctccaatcgctccagcagtgagaccaatagca gccttctggactaag
Download
page-top