Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ607218
Length 717 bp
Fasta Format > rwhva12e15
gacaacggaattcgagaattcatcagaaacagtacagctacttcatatat gtagcatagatgtaccgatgcaattctacagttacaacagctagtgccat aactacgacattgtatggataaatcattgtacacgaataatcacggaact agatagcgacatagtaacaacaatgctctcttgtctttcttcattcctcg cacagagagaagggggctttgaagaggattattctataaaaattgctcta cagcaggaatcctctaccctcattgcaaaggaagatccttgtgggtgtac acaactcccttgtcaccgttcactacttgtccactccctcgcagaatgca ccgagtggttaaaagaccgtcgacgccaacaggtccacgggcatgtatgc gccctgtacttatgccaacctctgcacctagaccaaagcgagtcccatca cagaaccttgtgcttgcattatggaacacagcagcactgtcaacttgttg tagaaaagtatccgctgacttcttatcagttgtgataatacaatctgtgt gtgcacttccataacgatttatatggtcaatcgctgactgcacatcatca acaaattcgagggtgcatgccattgagctatactcatgatgaaatgaatc taccttcggtactttcaatgtgtcatgtgcgacaggcccaccataaataa caactccttctttcgca
Download
page-top