Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ607041
Length 232 bp
Fasta Format > rwhva11j15
tacggcacattcgtactctcatacttttccccgggtaaaattcacacagc acatgatgctgcatcgcgcgcatcgcacgcagctgatccatcaacagccg acggcggcggacgggcaatcaacggccagctcacaggctgggcaccctct cggcggcgccggagatgacggtgagcaggttgttgccgaaggggtcgctg aggtgcgcgcanaggttctccaaggggccctc
Download
page-top