Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ606975
Length 649 bp
Fasta Format > rwhva11f03
gcaagatagtactggtatcaacaagtacctggaagtaacaccacgaactt ggccattcagtgacactacaagtacaacaatggtggaaacattaggacta gagtgttaagtttcccatccaaacgtgtttggctactagagatatgctca attattgtagagaatacagaagatgataggggtgatatacaacatgcttg ggagacgaatcattgtgtgggagcaatgtgatatgcggacttcactttct tctccaagagggagacatgcttatcaagcatggacaccactgcctcaaac tcactcacctgctggtctatcgcgtcgatctgtgttgtgtactcgtcaaa ccgttggtttttctcgttcagctgttctacaaagacccgcagaccggatg caacatctccgtggttactgtactcctctgtcacgcgttggttcatcttt tcaagcagcgagagctggttgttggttccctggagctcgccgcggaccat gagggagacgttggtgaagagctcggacagcgagtcggcgagctcgtctc tctgccctgccgccgcctcctccttcgctggagtcgccatcgccggcgct tcctcccgctcccgccgtacacctgtctcggagtaggaatcgggcttgg
Download
page-top