Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ608867
Length 868 bp
Fasta Format > rwhva18m20
cttaacttgggaaggctaggtgcaggttcatacagcatgaagctgccttc aaatgaaactatgagtacatgatatatcgtgtacctcccttttttgggaa ttatgcatatttcaggaataatttggatgatagtgcaaacttcatacaaa tatcatgtctcatgagctatgataaggcgtgggtttgtaatcatctgctt agaaactggcatcctctgttgtcggcctcctcaagaaataacgcaagcta ttcgcgagaacctgttgcaaagccttgattaatggcttgccccggtaact gacatggaattttgccttggccagtagcccctcagtgtcaaattctccag attggacagtgatattgatgtcagcaatgatcttaactagatcaaccaac aaccctggacggtcagctgattccacaacaagtaaacttctttcaggacc atcgtcatagatctctatgtgagttgctatgtccacatcaaccacttccg tagggggctctagcccaaaagttgcacccatggccaattgactgctagct tcaggatgatactcaagcatgttgttaataattgtcagtcttactgcttc taacaactctgggtcatcaattttgcgaccagttgacgactttgttatag cgaacttattgtgcttgccagaagaatcgaggcaaacactagctttcaca acatttagccctaaattcctcaaggcactcatagtatcaagaagatcccc aagacggtcacccaaggttacttccacaatagttgcatccggatctgagt cttgatctattataaccttcggtgtagggactgtattactgttgctagag ctcccattctcaacagct
Download
page-top