Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ608835
Length 486 bp
Fasta Format > rwhva18k20
ggcggggcttgttcacgtaattacacccaatacgacgataagcttagaca gatagcacttcaaatttatttgtgtttattggcacatatgtctgcaccac catggataaaagtaggttctgtggcctaggaagaagcggatgcggcggca gcctcctcgagcagctgcttcaccttggtgatgtagtccgccatcgcctc ctccttggatttcgcttcgacggacttccaggcgtcccacttggccttgc ccttaaggtcgaacattccggggcgggctgtgttgacgggcccgacggtg gcctgcttgtagaggctgtagaggcagagcatgctctcgttggtggtggt gtcgggcagcgtcttggccttctccgcgtactcctcaaactcctcctgca gacccatgtcgatcggctcgtcggctgctccgctctcctcggcttcgata cgttcgaggcgataagaacgatcgattcgatgcgag
Download
page-top