Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ608820
Length 865 bp
Fasta Format > rwhva18j21
ttggaaggctagtgcagttcatacagcatgaagctgccttcaaatgaaac tatgagtacatgatatatcgtgtacctcccttttttgggaattatgcata tttcaggaataatttggatgatagtgcaaacttcatacaaatatcatgtc tcatgagctatgataaggcgtgggtttgtaatcatctgcttagaaactgg catcctctgttgtcggcctcctcaagaaataacgcaagctattcgcgaga acctgttgcaaagccttgattaatggcttgccccggtaactgacatggaa ttttgccttggccagtagcccctcagtgtcaaattctccagattggacag tgatattgatgtcagcaatgatcttaactagatcaaccaacaaccctgga cggtcagctgattccacaacaagtaaacttctttcaggaccatcgtcata gatctctatgtgagttgctatgtccacatcaaccacttccgtagggggct ctagcccaaaagttgcacccatggccaattgactgctagcttcaggatga tactcaagcatgttgttaataattgtcagtcttactgcttctaacaactc tgggtcatcaattttgcgaccagttgacgactttgttatagcgaacttat tgtgcttgccagaagaatcgaggcaaacactagctttcacaacatttagc cctaaattcctcaaggcactcatagtatcaagaagatccccaagacggtc acccaaggttacttccacaatagttgcatccggatctgagtcttgatcta ttataaccttcggtgtagggactgtattactgttgctagagctcccattc tcaacagctgcaggc
Download
page-top