Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ608485
Length 843 bp
Fasta Format > rwhva17d10
tattcagctaaaatttgagcaggttctcatcagctcgtaatttcctatca gcaacttggtgtacaaccggcttgtttgagcactgattgcagagggggaa aggcagcaatgcaactctgtttaactattgtgcttcgctcaacaccctga actaattatttcccctaaaaatgggagtgctctcgccacgcgaactcatg tcacagcgccagaccattcttcatcagtcgagcaaaacgctgaagaacct ctgctcggcgcaggtccaggctcaaccccgccggcgtgggaatggagagg cctcacaggcacttcttgatgtctggaaataatgacttctctttgtttgc tgcctcgacgtcgtcaggcgatgctacagccaccacaaccccattgtcat tgatcgtttctacagcatcggcaaactccttgaaatccttcacgctggtt gcgagtatctcttcgcgcctttgctggcgttcctcctcagtgatgcccaa caaataccgcatcaggctgctgtaacctttagcatctggtagctggtagg aatcaacatcccctatggttccaataatagcttttgtgagagcatcatca tctacctctagttctctgaggaactttgcagtcccatcatagacctctag tgttttcagcaagttcggatcacggtatgacaaataggaaaagacccctg aatgagtgtcaaaatcacagaaccctccatatgcgccaccactaactcga acgcggtcccataaccatgtgttgcttatgtgcttggatatgacataggc acttccattaagttgggtatccactttggtataagtttccagc
Download
page-top