Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ608381
Length 656 bp
Fasta Format > rwhva16m12
acaaaatcatatagaacaaaaggtatgctccggtcagaaagcagagtcgt acagcagagttttggacaaaagtgaagttcacaaaagaccttcatacgag ataggccattgtttcaactcgtagtttaggccttgccggactcctcgcaa cccggtggcctaaaggcgatgaagctgacgcactgcacctggcgcaggtt gtcgaagccgatgacacggacataggcgtcagggtactccttcttgacct cctccacctcgttcagcacctgtgtggcgtcagtgcacccgaacataggc agcttccacattgtccagtatcggccgtcgtagtacccgggggagctgtt gtgctcacggaagacgaagccaaccttgctgaactcgaggcagggcaccc actttgagcggatcaggtagtcgacctgtttcaggagggcctccgtggat aggggtggcaggtaagacagggtctcgaacttcttgatgccctcaattgg ccacacctgcatgcacctgatccttccgccattgctgacgctgctgaggc tgccgctggagcggcggccgacggggagaccggctgtggacttgagcccc tggaagggtgcgacggtggtagccgaggaagccatcacggcgggggccat ggtaat
Download
page-top