Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ608081
Length 842 bp
Fasta Format > rwhva15j07
aaccagggtctcataacatccagggtttcaccaaagcttacattaggaca gtatgtaaggcacaagacagacaccaccaagggcacgatatgcagcgcta acagctgaacagctaaaatatacccagtacgaacaatgcccttaacaaaa ctcagccaatactaaaaactgcttggtgtctgaaacagtgatttggatat caattgtggaattacttcttcttgatggcagccttggtcaccttggcccc ggttgggtccttcttctcaacgcccttgatgacaccaacagccacagtct gcctcatgtcacggacagcaaaacgaccaagaggagggtaagtggcaaag gtctccacaaccatgggcttggtgggaatcatcttcactatgccagcatc accattcttgaggaacttgggcagggcctccagctccttaccagaccgcc tgtcgatcttggtcaccagctcagcaaacttgacagcaatgtgtgaggtg tggcagtccagcactggggcgtagccgttgccaatctgaccagggtggtt catgatgatgacctgggaggtgaagttggctgcctccttggcagggtcat ccttggagttggatgcaacaaacccacgcttcagatccttcacggcaacg ttcttgacgttgaagccaacgttgtcaccaggaagcgcctccaggagaga ctcatggtgcatctcaacggacttgacctcagttgtcagaccagtgggac caaaggtaacaaccataccaggcttgatgacaccagtctcaacacggcca acaggcacagttccaatgccaccaatcttgtaaacatcctgt
Download
page-top