Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ608027
Length 642 bp
Fasta Format > rwhva15g09
cttattaaggcaacgcatacgagcatatggtgcaaaaatgtgcagtacaa caactctgttggttcacttggcaggatcaacatactgaaagacgtcatct cgnttactccctcgaaatgttgtatgccccattggacttagctatgtggn attttcctatccctttatgaaaggtctactggagttccacagagctcacc gatctccttctctagaagtcgcatgagatttactccagtccgcctataaa tccaactgtctgttgctgcatcccagtcaaatctagcaggcccactcaca ggtgaagatagccagatttgtctgnttggcgtttgcttgtttacaacata ggtccccaaatcgcctagcctcaatgttanaacttgattcccgtaatcta tgtcgaagccatccatctgctgagaatcaccatattcctcaagtttttca agcaaatcatgtattgtatcatctgctaatttatggaacttatcctctgg cattatcaacttgtggtccaccgcggatggggcgggcacatctccggcgg actgttgagccggaggggtcgacganaagaccctagaggagaagagcagc gcccacggcgatccacctgacggcttcntcgcggcggcggtg
Download
page-top