Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ608024
Length 919 bp
Fasta Format > rwhva15g06
gtggatcattattggagccaacaattacagtagtatcatcatattatgta gtaaatggaccgaatatttccgcatatatcttcccccctatacatatcaa gcatagcaaccagttttcttcaccatagttacagcttacagctaattaat caacttcaattgctggtagaaaagagcagcattgtattatatgtagatgc ggttgtcttcttctctcttcacagcctcgagtggtcctggtattgctcca tgaacgagtcgttgaacttcttgaagctcgacatgatcgccggcatgtcc tcctccgcgggcaggatcgtcgtcctcagatggaacaccccttctttctg accaaaacctgagcctggaacagtggatattccagtggcttccagaagct tgaggcagtagtaaacatcgggcgctttgccagcgctttttgctacatcc atagctctttgcggcagccgtatttgcgggaaagaatacatagctccttc tgtgaaattgcagacaacatttcggcaactattgaaaccgtctgtcatta tttgtgccctcctcctcaaagattcaaggatagacttactttcagcagaa tacttcaggtacgagatgtctccaggtttaggagggttcaccataagtcc catgaagatctgcccaggaacatttggactcagcgcgattgatgcaacct tgtaaatctcgtcgacagtcttgggaggtatgtttgtcatttcaaagtac ccaccacgttgtccacactctccccaatatcctttggacacagtatggaa agaaaatcagctgaacttccctgcttactggaggacccatgtcaaacata acctttcttgcacttataaacggacgttcatcttgataaacattctgntg ataaacttcatctgcaagc
Download
page-top