Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ608017
Length 800 bp
Fasta Format > rwhva15f22
atctgaatacaaaggattaaaatcaaaactgggtttaagcacttgagagt ttgatatggcagtatagcacatgcaattacctagtgaatattaacaagta ctgtacgtaggtagcatatctatctggtttcaagattacaacacggtttc atccaagtgtatgtatatgtccatgggtgtttataaaacatagctgagga atcacaaacaaacttcagtgtgctgccagagcaagaccagcattgtcgtc cgtgagcctcttgacatactcttgccgcaccggatggtcctcctgaggcc ggttgtgcgccgtccacactggttctcccaggaagagcctcatgagcttc acatggttggcggcgtcgagggtgaaccgatgataaattccagccggcag cacgatcatgcccccttcttttatccagatccgaacccacttgtcatcct tgtcgcgcacatcaaagtacccgccgccttccaagcagtaccggatctct tcgtcggcatgcatgtgctctgtgaagaagttcttgagcttctcctcaaa gtttgccaactttccagggcatatgtcgagatagtccatgtagttgtatc ctctgtctttgcggatcttcgctagctcttcttcgctttcaggcttcttt gggtccaaatgccagtataacacaccaatctcttggagcttggagagagg caggagctccccgtggttcttgaggtcctcgccgtcctccccaaccatcc acacctgaggagccatgttgagcggaatgaatggangaaaaccaacccag
Download
page-top