Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ608011
Length 687 bp
Fasta Format > rwhva15f14
atttctgtatctgaactaaagcacatgcaactcgcatgcctaccacagga cgggtataaatataagaactaatgtgtcgagaacaaaaaatacaattaca caggcgaagccaggaatcctgtacaagaaagcagcagttcaacaggggcc gggccttgcagccaagcgtcagcgaaccaatttacaggggtggttggtta cctaggctgcaagaccgtgcagaagaatcttcgacggaatctgcaagctc gtttccagaagatgccttggacagagcttccacaaaattgcagcctttgg tgacgttagtgatttagaaggaccgcggtctgagaaaatcactttcaagt atcgcagtaagaacgcttaacctccgattagctttgatcattttgacgat tgggcttcggctagtatcacttggcagattgtactgctgtttttttgcct ggcaagtactctctcaaactcagcacaagcttcaggcgagtcttcttcgc tgggtggcaccaactgccagaacagtggcagatatgcctcccattcgttc agaattttggcacctttcgtgctgcccgttttttcaacataggcctcaat caagcccttgagctgcatctgcccagctggagcattcactctctgcatct tgacaatctccttgtttaccttcgggactagtgtatc
Download
page-top