Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ608009
Length 753 bp
Fasta Format > rwhva15f12
tataatgggcaggttaaaacaactcgcaagaagcagacttgttcttgata ctattacacaagagagcacgctaaagacaggttccatggatgatagctag atccacaccatatctccagatccttgcacagttgggactgacgagcctta aacgttgggagaggcgccctctgcgggcttgaactcgacgagcttcttga catccagccacagctgctccaacaccttggcttcatacagcttctttgcc ccgccttcatcgacctggattgtgatgtagtagagcctgccggcaacagc ttgctccttgaccttcaccactttctccaactccagctgggtattctgca gcggtgaattcagattagaccaatgcaatactactactacgcaaggaagg acctgcgtgcgtcgatcgaatcgtccggccggccggccgggtgtcgaaca cgggcatacagattcaacaaagggaagaagaaggggtggcgggtcgaggg cttacgccctccttgttgtgctcggagacggcgaagcgggcgaggtcgac gatgtaggggtcgttctcccgccccancgagtccacgatgcctcccgcca accgccgcgcgggttccgccgccatggcanccttctctcgtgcgctctgc ttctgcgtctgaatanacggnangacnanggcnantancangancanggc ggncacngatcctaanacccngnggngtttccacatctccnncnatcnnn ntc
Download
page-top